الهندسة والفنون
مع باقة ورد عطرة منتدى الهندسة والفنون يرحب بكم ويدعوكم للإنضمام الينا

د.م. أنوار صفار






الهندسة والفنون

 
الرئيسيةالرئيسية  البوابةالبوابة  التسجيلالتسجيل    دخولدخول          

شاطر | 
 

 الادوية المحظورة اثناء الالعاب الرياضية - 19

اذهب الى الأسفل 
كاتب الموضوعرسالة
الصيدلاني راتب الحنيطي
المشرفون
المشرفون
avatar

الحمل
تاريخ التسجيل : 16/12/2014
العمر : 54
البلد /المدينة : عمان

بطاقة الشخصية
المجلة: 0

مُساهمةموضوع: الادوية المحظورة اثناء الالعاب الرياضية - 19   1/19/2015, 11:01

الجينات والرياضة ( التنشيط الجيني ).

لقد شاء الله الخالق أن يكون أكبر سر من أسرار الحياة ضمن ما يسمى المادة الوراثية الموجودة في كل خلية من خلايا الجسم. وبشكل أدق فان هذه المعلومات والأسرار وضعت داخل نواة الخلية التي لا يمكن رؤيتها الا تحت المجهر بعد تكبيرها آلاف المرات. أما المادة الوراثية نفسها فهي موجودة على شكل خيوط رفيعة متطاولة ومتناثرة ضمن النواة ، والتي يطلق عليها الحمض النووي ( DNA ) ، وعددها يختلف من كائن حي الى آخر ، فهي في خلية الانسان ستة واربعون كروموزوما، وأنها مكونة من (3.2)بليون جزيء وكل جزيء يمثله عنصر من العناصر المعروفة ( أدينين ، سايتوسين، غوانين ، ثايمين ) والتي يرمز لها بالرموز التالية
( A,C,G,T ) ، على التوالي، ولو ان هذه المليارات من الجزيئات كتبت بخط مستقيم ( TCCTGGTCTTAAGGGCTCAAA ) فان هذا الخط سيمتد الى مسافة تقدر بخمسة آلاف كيلومتر. ولو أردنا كتابة المعلومات الوراثية الموجودة في خلية واحدة من خلايا جسمنا فإننا نحتاج الى مليون ونصف المليون صفحة من القطع العادي.وقد اتفق العلماء على تسمية هذا الترتيب للعناصر الوراثية بالشيفرة الوراثية، والتي من الممكن للعلماء قراءتها ولكن من المستحيل التوصل الى الفهم الصحيح والتام لهذه الكتابة فيما يخص كيفية عمل المورثات وتفاعلها مع بعضها البعض.
ولذلك فان أعظم انجاز علمي عرفته الانسانية في تاريخها الطويل هو حل الشيفرة الوراثية، مما يجعل عالم الغد مختلفا كل الاختلاف عما عرفه الانسان الى وقتنا الحاضر. وهذا التطور الهائل يضع ثلاث مسائل على سلم أولوياته المطروحة ، وهي :
- موضوع معالجة جميع الأمراض والعاهات الوراثية ، والذي سيكون ممكنا في المستقبل القريب، ولذلك علينا أن نتصور مجتمعا خاليا من الأمراض.
- تعريف وتحديد بشكل دقيق للمرض الوراثي الذي يجب تصحيحه .
- واستكمالا للنقطة الثانية ، يبرز موضوع امكانية تحسين وتطوير العرق البشري باستخدام الطرق العلمية، كتغيير لون الجلد والعينين والقامة والامكانيات العضلية والجسدية.
ان ما يخشاه البعض هو ان أول من سيستخدمون طرق المعالجة الوراثية هم الرياضيون، وليس المرضى الحقيقيون، لأنهم بحاجة الى مثل تلك المعالجة لإزالة بعض العيوب التي تقلل من فرص الفوز أو تنشيط عوامل جسمية تزيد من نسبة فوزهم.
فهناك مثلا مرض تصلب الشرايين الطرفية ( peripheral atherosclerotic disease ) المتمثل بتقلص وانكماش الأوعية الدموية التي تغذي الأطراف العلوية والسفلية من الجسم ، وهذا المرض قد يؤدي أحيانا الى فقدان الأطراف المصابة ، ويحاول الأطباء استخدام طرائق المعالجة الوراثية لمكافحة هذا المرض عن طريق ادخال نسخة سليمة من مورثة خاصة الى تلك الأوعية الدموية تعمل على توسيعها ، وتؤدي الى تحسين الاداء الرياضي.
وبفضل التقنيات الحديثة ، قد يبدو ممكنا أيضا استخدام المورثة المسؤولة عن تصنيع هرمون ارثروبيوتين ( E.P.O. ) الذي يؤدي الى ازدياد كريات الدم الحمراء في الجسم ، الأمر الذي يمكنها من حمل كمية كبيرة من الأكسجين الذي يحتاج اليه الجسم مما يؤدي الى تحسن في الأداء الرياضي.
ومثل هذا الأمر ( الغش) لا يمكن الكشف عنه بأي وسيلة - على الأرجح - لأن كل البشر لديهم نفس المورثات الجينية.وبالتالي لا يمكن تجريم الرياضي بقصد الغش أو زيادة القدرة الجسمية بشكل غير قانوني.
ولذلك فقد أظهرت اللجنة الأوليمبية الدولية ومنظمات رياضية أخرى في السنوات الأخيرة قلقاً عميقاً إزاء احتمالات إساءة استخدام تكنولوجيا تحويل الجينات. لكن عالم الرياضة يبدو عازماً على المضي قدماً في استغلال هذه التكنولوجيا سعياً إلى الحصول على الميداليات الذهبية والبطولات. وعلى اللجان الرياضية التي كانت تعتمد خلال السنوات الماضية لكشف الغش في استخدام المواد الكيميائية المحظورة على أبرع علماء الكيمياء ، أن تبحث الآن عن اقدر الخبراء في مجال علم الوراثة ، وتعد هذه النقطة نقطة انعطاف من حيز الكيمياء الى حيز البيولوجيا، ومن هنا فمن المنتظر أن تكون الاختبارات الجينية موجة المستقبل.
الجدير بالذكر أنه وفي العام 2003 أصدرت الوكالة العالمية لمناهضة المنشطات (WADA) قراراً بحظر تنشيط الجينات، لكن بعض العلماء توقعوا ظهور حالات إساءة استعمال المنشطات الجينية في الدورات الرياضية المقبلة.
الرجوع الى أعلى الصفحة اذهب الى الأسفل
دكتورة.م انوار صفار
Admin
avatar

تاريخ التسجيل : 04/04/2010
البلد /المدينة : bahrain

بطاقة الشخصية
المجلة:

مُساهمةموضوع: رد: الادوية المحظورة اثناء الالعاب الرياضية - 19   1/19/2015, 16:12

لقد شاء الله الخالق أن يكون أكبر سر من أسرار الحياة ضمن ما يسمى المادة الوراثية الموجودة في كل خلية من خلايا الجسم. وبشكل أدق فان هذه المعلومات والأسرار وضعت داخل نواة الخلية التي لا يمكن رؤيتها الا تحت المجهر بعد تكبيرها آلاف المرات. أما المادة الوراثية نفسها فهي موجودة على شكل خيوط رفيعة متطاولة ومتناثرة ضمن النواة ، والتي يطلق عليها الحمض النووي ( DNA ) 


جزاك الله خيرا لما تقدم







 


br>


 


اللهم إني سامحت كل من أغتابني أو ذكرني بسوء في


غيبتي وأسألك في ذلك الأجر والمغفرة بلوغ مراتب المحسنين

الرجوع الى أعلى الصفحة اذهب الى الأسفل
http://eng-art.montadarabi.com
ابتسام موسى المجالي
مشرف
avatar

تاريخ التسجيل : 20/04/2010

مُساهمةموضوع: رد: الادوية المحظورة اثناء الالعاب الرياضية - 19   1/20/2015, 22:15

بارك الله فيك لمعلوماتك القيمه
الرجوع الى أعلى الصفحة اذهب الى الأسفل
فؤاد حسني الزعبي
المراقب العام المميز
المراقب العام المميز
avatar

العذراء
تاريخ التسجيل : 22/10/2011
العمر : 74
البلد /المدينة : فيينا - النمسا

مُساهمةموضوع: رد: الادوية المحظورة اثناء الالعاب الرياضية - 19    1/21/2015, 15:50

شكرا لك لهذه المعلومات






الرجوع الى أعلى الصفحة اذهب الى الأسفل
 
الادوية المحظورة اثناء الالعاب الرياضية - 19
الرجوع الى أعلى الصفحة 
صفحة 1 من اصل 1

صلاحيات هذا المنتدى:لاتستطيع الرد على المواضيع في هذا المنتدى
الهندسة والفنون :: --الطب والصحة العامة(المقالات) :: الصيدلة والدواء-
انتقل الى: